and Immunoprophylaxis)
Table of contents :
|
|
|
)
after organ transplantation
in a donated organ to a transplant
patient : it is rare, but the chances of it happening long after the donor
was treated are not extremely unlikely.
inhibitors. Calcineurin is required for NFAT
nuclear translocation and transcription of IL-2..
(Cipol-N®, Neoral®,
Restasis®, Sandimmune®), discovered by J.Borel
in 1978, used clinically since 1980.
production.
,
hypopotassiuria,
hypouricuria
=> hyperuricemia,
(cyclosporine-associated
arteriopathy)
presents a serious management problem
(FK506®, Prograf®, Protopic®).
The drug was first used in liver transplantation and may substitute for
cyclosporine entirely or be tried as an alternative in renal patients whose
rejections are poorly controlled by cyclosporine.,
hypopotassiuria,
hypouricuria,
(cyclosporine-associated
arteriopathy)
presents a serious management problem(more
common than with CsA)
to Th2-polarized
immune responses due mainly to down-regulation of the Th1 cytokines
: inhibition of STAT4 phosphorylation is seen within 2 hours, while downregulation
of IL-12Rb1
and b2 chains
occurs after 3 days of treatment. They interfere with the protective and
defense mechanisms of activated macrophages, rather than resident macrophages.
induce apoptosis in macrophages and monocytes, preventing the release of
IL-6 and IL-1
by preventing CD178
/ Apo1L / FasL upregulation via glucocorticoid-induced
leucine zipper (GILZ) and activation of glucocorticoid-induced
TNFR family related (GITR),
which can inhibit CD3-mediated but not Fas-mediated apoptosis. In cases
where glucocorticoids are overexpressed, this balance could be shifted
such that a higher level of activated T cells survive and thus a greater
population of thymocytes that recognize self could survive. Indeed, in
autoimmune disease models in animals and in patients with multiple
sclerosis,
there is a higher basal level of glucocorticoids. Hence long-term corticosteroid
therapy would cause relapses.|
|
|
|
|
|
| hydrocortisone |
|
|
||
| cortisol |
|
|
|
|
| cortisone |
|
|
|
|
| fludrocortisone |
|
|
|
|
| prednisone |
|
|
|
|
| prednisolone |
|
|
|
|
| 6a-methylprednisolone |
|
|
|
|
| deflazacort |
|
|
||
| triamcinolone |
|
|
|
|
| betamethasone |
|
|
|
|
| dexamethasone |
|
|
|
|
,
growth retardation, toxic
cataract.
The side effects of the glucocorticoids, particularly impairment of wound
healing and predisposition to infection, make it desirable to taper the
dose as rapidly as possible in the immediate postoperative period
.
They also inhibit the maturation/differentiation of DCs, their expression
of costimulatory molecules and their production of IL-12,
but enhance their production of IL-10.
: FTY720 (source : Novartis)
- a synthetic derivative of the antifungal agent myriocinref
- causes immunosuppression in animal models of transplantation and autoimmunityref.
Initial observations showed that FTY720 causes apoptosisref,
but subsequent studies have reaised doubt that its pro-apoptotic activity
is responsible for immunosuppressionref.
The drug markedly decreases lymphocyte
recirculation
to blood and peripheral tissues, including inflammatory lesions and graft
sites (i.e. decreases the number of circulating lymphocytes and increases
lymphocyte numbers in the LNsref).
FTY720 treatment makes T-cell homing to LNs less dependent on CCR7.
Interestingly, FTY720 also prevents lymphocyte egress from the thymusref
and from the LNs into efferent lymphaticsref.
Recent studies have shown that FTY720 is phosphorylated by sphingosine
kinase to an active metabolite that resembles sphingosine-1-phosphate (S1P)
and binds to 4 of the 5 known S1P receptors, EDG1
/ S1P1,
EDG3
/ S1P3,
EDG6
/ S1P4,
and EDG8 / S1P5ref1,
ref2.
S1P1 and S1P4 are found on lymphocytes and can modulate
lymphocyte responsiveness to chemokines. Recent findings indicate that
FTY720 enhances the efflux of cysteine leukotrienes from T cells, and this
effect was required for its activity in T-cell homingref.
S1P receptors are also expressed by the endothelium. So, some of the effects
of FTY720 could be caused by action on vascular or lymphatic endothelial
cellsreduce
capacity to generate Th1
lymphocytes and down-regulate Th1-lymphocyte
effector functionsref
inhibit dendritic
cell maturation
derivative)
: use with tacrolimus alone shows promise as a steroid-sparing regimen,
especially in patients who would benefit from pancreatic islet transplantation,
where steroids have an adverse effect on islet survival.)
that inhibit de novo purine synthesis.
unresponsive to other agents
(27%) and occasionally thrombocytopenia
(5%)ref.
It is recognized that persons with low levels of activity of the enzyme
thiopurine methyltransferase are at increased risk of bone marrow toxic
effects, and consequently many physicians perform an analysis of TPMT activity
before the initiation of azathioprine therapyref.
Excessive amounts of azathioprine may also cause jaundice, anemia, and
alopecia. If it is essential to administer allopurinol concurrently, the
azathioprine dose must be reduced, since inhibition of xanthine oxidase
delays degradation. This combination is best avoided.
inhibits the expression of COX-2
and lipid peroxidation
inhibits PKA (Ki = 3 mM),
PKC (Ki = 8 mM), MLCK (Ki
= 12 mM) and p56Lck and Syk (Ki
= 15 mM) and activates caspase-3..
Regimen
: oral 2-3 mg/kg day; 0.1 mg/kg/day
inhibit Th1
cell activation and promote Th2
cell differentiation..
antagonists).
They are used in ...
inducers :
: it decreases Ab production, inhibits IL-6 and TNF-a
production, inhibits B cell development, inhibits the growth of naive
CD4 T cells after activation and production of IFN-g
by Th1
lymphocytes.
inhibitorsref,
collectively known as statins, because of their broad and extensive clinically
beneficial effects and their extremely low incidence of side effects, statins
might even be seen as the new aspirinref.
The concentrations of statins in tissues during therapy is unknown but
is probably <10 µmol/Lref.
Statins are used clinically to :ref1,
ref2.
Clinical benefits (reduction in cardiovascular events and mortality) directly
attributed to the cholesterol lowering effect of statins have been extensively
demonstrated in patients with atherosclerosis and cardiovascular diseases
with or without coronary artery disease symptomsref1,
ref2,
ref3,
ref4,
ref5,
ref6,
ref7.
At present, 5 statins are available in the US and most other Western countries:
atorvastatin, fluvastatin, lovastatin, pravastatin, and simvastatin. It
is estimated that about 25 million people worldwide are currently being
treated with a statin. The number of prescriptions for statins issued in
developed countries in 2000 was almost 30-fold greater than the number
written in 1991. WHO statistics indicate that there are about 200 million
people worldwide with coronary artery disease, stroke, other occlusive
vascular diseases, or diabetes mellitus. Consequently, a proposal has been
made that tens of millions of people at increased risk of heart attacks
and strokes should begin statin treatment before onset of diseaseref.
(Poynter et al. reported a 47%ref
reduction in the risk of colorectal cancer among long-term statin users
(i.e., > 5 years), as compared with short-term users or nonstatin users.
In contrast, a randomized trialref
and meta-analysesref1,
ref2,
ref3
have found either a slight increase in cancer among statin users or no
relation between statins and cancers. Although trials are often limited
to comparatively young, low-risk patients and have short follow-up, this
difference may result from methodologic limitations in the observational
study by Poynter et al.ref
). 3-hydroxy-3-methylglutaryl coenzyme A reductase activity is upregulated
in left-sided human colon cancerrefref1,
ref2,
ref3,
ref4,
ref5ref1,
ref2,
ref3,
ref4,
ref5
and CML
cells show more LDL processing than normal blood cellsref1,
ref2,
and cholesterol levels in leukemia cells often do not exhibit feedback
repression in high-sterol mediaref.
Rapidly proliferating tumor cells presumably require cholesterol for new
membrane synthesis. However, high cellular cholesterol may also improve
leukemia cell survival and impart relative resistance to therapy. Compared
with their parental cell lines, drug-resistant myeloid leukemia cell lines
show higher HMG-CoA reductase levelsref,
and drug-resistant lymphoid leukemia cell lines have increased cholesterol
and phospholipid levelsref,
suggesting that acute cholesterol responses may contribute to drug resistance.
Consistent with a critical role(s) for the mevalonate pathway in tumor
cell growth and survival, and with the rate-limiting role of HMG-CoA reductase
in this synthetic pathway, statins have in vivo or in vitro
activity against human head and neck, pancreatic, and CNS tumors and against
human myeloid leukemia cells in xenograft modelsref1,
ref2,
ref3,
ref4,
ref5.
Acute renal injuries caused by ischemia, oxidant damage, and ureteral obstruction
increase renal cortical cholesterol contentref.
Cholesterol levels are similarly increased in cultured human HK-2 proximal
renal tubule cells subjected to iron-mediated oxidant stressref.
In these kidney cell models, increased cellular cholesterol makes cells
highly resistant to subsequent damage, producing a state known as "acquired
cytoresistance." Reducing cellular cholesterol levels pharmacologically
blocks acquisition of cytoresistance and can generate profound mitochondrial
dysfunction and death in kidney cells, further demonstrating the critical
role of cholesterol in renal cell homeostasisref.
Although a majority of adult patients with AML initially achieve complete
remission with conventional chemotherapy, most eventually relapse and succumb
to drug-resistant disease. Given this prevalence of drug-resistant AMLs,
a number of workers have examined the potential antineoplastic effects
of the cholesterol-lowering agents commonly known as "statins," either
alone or as chemotherapy sensitizers. 2 groups have shown that lovastatinref
and simvastatinref
can sensitize AML cell lines to cytarabine. A phase 1 clinical study
showed that serum lovastatin concentrations of up to 3.9 µM could
be achieved without significant tissue toxicityref.
Similar doses of lovastatin is toxic to AML cell lines and to primary AML
cell samples but not to lymphocytic leukemiasref.
A subset of primary AML cell samples, but not normal myeloid cells, can
be sensitized to cytarabine and/or daunorubicin by mevastatinref.
Plasma membrane localization is essential to the function of many proteins
that impact cellular proliferation and/or survival. Because the membrane
localization of many of these signaling proteins requires mevalonate-derived
farnesyl or geranylgeranyl isoprenoid modifications, the antitumor effects
of statins have been assumed to be primarily due to their blockade of isoprenylation.
For example, Ras proteins are activated by mutation and/or overexpression
in a large fraction of human tumors, including myeloid leukemias, thereby
contributing to reduced apoptosis, increased cell proliferation, and poor
clinical outcomesref1,
ref2.
Isoprenylation of Ras and other similarly modified membrane proteins is
specifically mediated by farnesyl-protein and geranylgeranyl-protein transferases,
and FTIs can, like statins, induce tumor regression in mice carrying mammary
or lymphoid tumors overexpressing H- or N-Rasref1,
ref2,
ref3.
However, statin toxicity in primary AMLs is variable and not consistently
higher in samples with Ras overexpression or with Ras activated by "hotspot"
mutationsref.
Others have argued that non-Ras geranylgeranylated proteins are important
statin effectorsref.
However, dependence on geranylgeranylation as well as farnesylation can
be dissociated from statin sensitivity in AMLsref.
In addition, statin concentrations necessary to inhibit specific protein
isoprenylation are 100- to 500-fold higher than those required to inhibit
cholesterol synthesis in the same cellsref
and are higher than the concentrations that are toxic to AML cellsref.
The squalene synthase inhibitor zaragozic acid A (ZGA), which disrupts
cholesterol but not farnesyl pyrophosphate and geranylgeranyl pyrophosphate
synthesis, produced cell death only in the cell lines (ie, NB4 and HL60)
that mounted cholesterol increments in response to radiotherapeutic or
chemotherapeutic insults and that exhibited sensitivity to mevastatin.
Cotreatment of NB4 cells with ZGA and either cytarabine or radiation resulted
in a marked attenuation of the cholesterol increment that would otherwise
have occurred in these cells after exposure to cytarabine or radiation
alone. At the same time, the addition of ZGA to cytarabine or radiation
induced at least an additive toxicity in NB4 cells. This association of
increased toxicity with the attenuation of cholesterol increments provides
further credence for the concept of adaptive cholesterol responses as a
cytoprotective mechanism in particular AMLs. One of the arguments that
has been raised in the literature against a role for cholesterol modulation
in the antineoplastic effects of statins has been the inability of exogenous
squalene and free cholesterol to reduce lovastatin toxicity in NB4 cellsref.
However, cells do not always efficiently incorporate free sterols, as was
shown for K562 cells exposed to exogenous squalene and lanosterolref.
On the other hand, cells can efficiently obtain cholesterol from the ambient
environment by receptor-mediated import of LDLref.
Treating NB4 cells with ZGA in a serum-depleted (and hence cholesterol-depleted)
medium resulted in > 70% toxicity within 24 hours, while the addition of
LDL cholesterol (> 95% purity) to these cultures reversed the toxicity
of ZGA, further supporting the vital cytoprotective role of cellular cholesterol
in certain AMLs. These findings do not exclude the possibility that reduced
isoprenylation may contribute to statin toxicity in particular AMLs but
do highlight the possible importance of direct cholesterol modulation in
new antileukemia therapies. Nonstatin drugs that reduce protective cellular
cholesterol may be more desirable for eradicating cholesterol-dependent
leukemias for several reasons. Some AMLs are apparently able to further
up-regulate LDLR activity after treatment with statinsref,
which could limit the ability of statins to decrease protective cellular
cholesterol. In addition, statins apparently block the production of
a mevalonate-derived Ras inhibitor that accumulates when the mevalonate
pathway is instead blocked at a downstream step by a diphosphomevalonate
decarboxylase inhibitorref.
Therefore, statin treatments could potentially favor the growth of tumor
cells that are regulated by this inhibitor, whereas inhibition of cholesterol
synthesis distal to diphosphomevalonate decarboxylase activity would not
have this effect. Consistent with this idea, lovastatin can increase
proliferation in a large number of primary leukemia cell samplesref.
Squalene synthase inhibitors that block cholesterol biosynthesis at the
final committed step of the mevalonate pathway are being tested for hypercholesterolemia
indicationsref1,
ref2,
and squalene synthase inhibitors and other direct cholesterol-modulating
agents should be rigorously tested as chemotherapy sensitizers in AMLref.
The levels of mRNAs encoding HMG-CoA and LDLR are both increased by daunorubicin
(DNR) or cytarabine (ARA-C) treatments in almost 75% of cultured AML samples.
However, < 33% of AML samples significantly increased LDL accumulation
during drug treatments, suggesting that de novo synthesis is
the primary mechanism by which most AML cells increase cholesterol levels
during drug exposures. LDL increments are not correlated with cholesterol
increments in ARA-C–treated AML samples. However, LDL and cholesterol increments
correlate in DNR-treated AML samples where they are measured, suggesting
that a subset of AMLs may rely on increased LDL accumulation during treatment
with particular drugsref.
: rosuvastatin reduced arterial pressure in genetic hypertension and improved
systemic and regional hemodynamics in SHR and WHY hypertensive rat models
independently of cholesterol levelsref
despite the fact that LDL cholesterol is not directly associated with the
risk of stroke. Withdrawal of statin treatment abrogates stroke protection
in miceref;
protect cortical neurons from excitotoxicityref1,
ref2,
ref3.
36% reduction in heart attacks and a 27% reduction in strokes : overall,
the risk of death from strokes and heart attacks was reduced by 24%ref
seen in 2 clinical trials was generally thought to result from favorable
consequences of stringent and adequate lowering of cholesterol levelsref1,
ref2,
ref3.
Anyway it is tempting to argue that the clinical benefit observed with
statins in cardiac transplantation is not the result of the lowering of
cholesterol levels, as was suggested, but rather the result of their demonstrated
role as inhibitors of expression of CIITA. Indeed, the disruption of the
CIITA gene in mice has a very strong, favorable effect on the outcome of
cardiac transplantationref,
confirming that inhibiting CIITA, and thus MHC class II expression, is
beneficial in organ transplantation.
by cultured human monocytes and mouse peritoneal macrophages. The inhibitory
effect of lovastatin on FcR–mediated phagocytosis was prevented completely
by addition of L-mevalonate, farnesyl pyrophosphate,
LDL, or cholesterol to the culture medium. The inhibitory effect of zaragozic
acid was reversed by addition of LDL, but not by the addition of geranylgeranyl
pyrophosphate, to the medium. In addition, the effect of lovastatin on
phagocytosis is a function of cell activation because treatment of cells
with TNF-a or LPS prevented inhibition of phagocytosis
by lovastatin. The inhibition of Fc receptor–mediated phagocytosis of lovastatin
is related to its effect on cholesterol biosynthesis rather than its effect
on the formation of isoprenoidsref.,
the transcription factor for ABCA1
and ABCG1;
so statins may downregulate cholesterol efflux from nonloaded human macrophagesref
mRNA (t1/2, 43 versus 35 hours)
but not transcription => increased expression by 3.8-fold, completely preventing
its downregulation by ox-LDL in vitro (although L-mevalonate
alone did not affect ecNOS expression, cotreatment with L-mevalonate
completely reversed eNOS upregulation by simvastatinref)
=> increased endothelial nitric oxide (eNO) bioavailability (severely reduced
after AMI and in CHF; eNO bioavailability is also increased by HDL, which
activates both ERK1/2 and Akt, resulting in enhanced eNOS protein stability
and subsequent accumulation of eNOS proteinref:
simvastatin also activates the protein kinase Akt, producing a very rapid
improvement in endothelial function that is independent of changes in eNOS
mRNA levels. Simvastatin treatment can attenuate endothelial cell apoptosis
and augment angiogenesis in the ischemic rabbit hind limb model systemref)
=>
mRNA, the rate-limiting enzyme in the first step of de novo tetrahydrobiopterin
(BH4) synthesis, thereby increasing BH4 levels in
vascular endothelial cells. In addition to augmenting eNOS expression,
statins potentiate GTPCH gene expression and BH4 synthesis,
thereby increasing NO production and preventing relative shortages of BH4ref.
activity => enhanced LXR
activation => increased ABCA1
and ABCG1
expression => cholesterol effluxref
and ABCG1
expression directly, through antagonism of LXR
and indirectly through enhanced RhoA geranylgeranylation.
Interestingly, the increased event rate occurred during the first week
after the onset of symptoms and was independent of cholesterol levelsref.
Anyway short-term discontinuation of statin therapy in stable cardiac
patients apparently does not lead to a clinically important increased risk
of ACSsref.,
a transcription factor essential for the expression of MHC II genesref1,
ref2.
MHC-II molecules, expressed on the surface of specialized cells, are directly
involved in the control of the immune response and thus determine rejection
after organ transplantation. Whereas a limited number of specialized cell
types express MHC-II constitutively, numerous other cells become MHC-II+
on induction by the inflammatory mediator IFN-g.
This complex regulation is under the control of the transactivator CIITA,
the expression of which is tightly regulated by several alternative promoters,
operating under distinct physiological conditionsref1,
ref2,
ref3.
CIITA promoter IV is specifically responsible for the IFN-g
inducible expression of CIITA, and thus of MHC-IIref.
Statins may regulate IFN-g–induced MHC-II expression
on APCs and in this way reduce T-lymphocyte activation :,
USF-1, and IRF-1,
which are required for the activity of CIITA promoter IVref.
Atorvastatin treatment led to a significant down-regulation of HLA-DR and
the CD38 activation marker on peripheral T cells, whereas simvastatin up-regulated
both of these molecules. In contrast, superantigen-mediated T cell activation
was inhibited by simvastatin and enhanced by atorvastatin. No significant
effect of statin treatment on inflammatory serum markers was detected.
Thus, immunomodulatory effects of statins on human T cells are first demonstrated
in
vivo and are differentially induced by 2 different statins: atorvastatin
led to a MHC II down-regulation and may therefore be investigated for treatment
of chronic transplant rejection; simvastatin inhibited superantigen-mediated
T cell activation, which might explain reduced mortality of simvastatin-treated
patients with staphylococcal bacteremiaref.
,
CCL2
/ MCP-1,
and CCL5 / RANTES.
Coadministration of mevalonate reversed the effect of statin on leukocyte
recruitment. The inhibition of sterol synthesis by squalestatin did not
have any anti-inflammatory effect, indicating that the biosynthesis of
nonsterol compounds arising from mevalonate is crucial for the in vivo
regulation of cytokine and chemokine production by statins. Their inhibition
by statins may account for the reported anti-inflammatory effects of these
drugs and may provide a biochemical basis for the recently reported effects
of statins in the prevention of cardiovascular disease and mortalityref
in the vessel wall. In addition, rosuvastatin inhibited vascular expression
of p22phox and superoxide production, as well as diminishing
plasma 8-isoprostanes concentrationsref
a-toxin significantly inhibited exotoxin-induced leukocyte rolling
from 71±10 to 14±4.7 cells/min (P<0.01) and adherence
from 14±3.5 to 0.4±0.2 cells (P<0.01). In addition, simvastatin
pretreatment significantly inhibited transmigration of leukocytes
from 10.5±1.2 to 4.2±0.9 (P<0.05) cells, and decreases
by 50% endothelial cell surface expression of adhesion molecule P-selectin.
Furthermore, simvastatin treatment resulted in enhanced expression of eNOS
in the intestinal microcirculationref.
with subsequent reduction in IRAK activity and cytokine and B7-1 expression.
These effects were mediated via inhibition of protein geranylgeranylation
and farnesylation. Effects of statins were reversed by mevalonate. Whereas
wortmannin and LY294002 inhibited the statin effect, incubation with a
specific RhoA kinase inhibitor had no effectref.
production in vitro and in vivoref
was identified as 1 of 25 genes whose expression were upregulated in CAD
and downregulated by statinsref
expression by 50%, an effect that was not reversed by the HMG-CoA reductase
product mevalonic acid (400 µmol/L). Transcription factor analysis
revealed an inhibition by atorvastatin of NF-kB
+ STAT-1-dependent
de novo synthesis of IRF-1, governing cytokine-stimulated
CD40 expression in these cells. One consequence of this statin-dependent
downregulation of CD40 expression was a decrease in CD40L-induced endothelial
IL-12 expressionref.
Statins
reduce the expression of CD40 on atheroma-associated cells in vitro,
as well as on atherosclerotic lesions in situ in patients treated
with statinsref.
These results have been confirmed by other investigatorsref1,
ref2.
Since CD40 and its ligand CD154 have been implicated in several crucial
immunologic pathways, these latest results, together with observation of
the reduced MHC-II expression, provide even more evidence that statins
have the potential to modulate the immune systemref.
Elevated CD40L levels in patients with hypercholesterolemia and ACS, and
elevated sCD40L levels have been associated with increased risk of cardiovascular
events. Statins, glitazones, gpIIb/IIIa inhibitors, and clopidogrel have
been demonstrated to effectively reduce CD40L levels both in vitro and
in
vivo. Abciximab has been shown to reduce the occurrence of death or
myocardial infarction during 6 months of follow-up in patients with ACS
who had the highest levels of sCD40Lref.
mRNA and protein expression. Treatment of 21 normocholesterolemic men with
simvastatin (20 mg/d for 2 weeks) decreased CCR2 protein and mRNA expression
in circulating monocytes. Promoter and electrophoretic mobility shift assays
showed that simvastatin activated a peroxisome proliferator response element
in THP-1 monocytes. Moreover, simvastatin-induced CCR2 downregulation was
completely reversed by the synthetic PPAR-g
antagonist GW9662. Simvastatin-treated monocytes showed little chemotaxis
movement in response to CCL2 / MCP-1,
a specific CCR2 ligand. Treatment of C57/BL6 mice with simvastatin (0.2
µg/g body weight IP, daily for 1 week) inhibited transmigration of
CD80+ monocytes to the MCP-1–injected intraperitoneal space.
Moreover, few circulating inflammatory cells from simvastatin-treated Sprague-Dawley
rats (0.2 µg/g body weight IP, daily for 2 weeks) were recruited
to the aortic wall of hypercholesterolemic littermatesref.-/-
mice, independently of cholesterol lowering. In this model, cholesterol-lowering
effects can be presumed minimal, because hypercholesterolemia is primarily
due to increases in chylomicron remnants and VLDL, which cannot be cleared
by hepatic LDLRs or LRP via high-affinity binding to apoE. The absence
of significant cholesterol-lowering by statins in this model has been experimentally
validated before and used to demonstrate cholesterol-independent anti-inflammatory
effects of simvastatinref.
Surprisingly, in a longitudinal experiment spanning a much longer period
(24 weeks), a significant temporary increase in plasma cholesterol was
observed, the reason for which remains unknown. Although the extent of
atherosclerosis increased over time in both groups and the higher plasma
cholesterol level in the treatment group was associated with a consistent
trend toward larger lesions, the frequency of bleeding into plaques of
the brachiocephalic (innominate) artery was markedly reduced by statin
treatment after 6 weeks and showed a 49% reduction when all time points
were analyzed together. This was accompanied by an even greater reduction
of intraplaque calcification. Animal models of plaque rupture have been
severely criticized in the past, and none more than murine modelsref.
It is now well established that several transgenic and knockout models
develop advanced atherosclerotic lesions not only in the aortic origin,
where particular anatomic and hemodynamic conditions may influence its
pathogenesis, but throughout the entire aorta, major aortic branch sites,
and coronary arteriesref1,
ref2,
ref3,
ref4,
ref5.
The occurrence of plaque rupture in mice has long been denied, but again
"the mouse may get the last laugh"ref.
Superficial and deep plaque erosion, intraplaque bleeding, occasional thrombi
originating from the necrotic core of advanced atheroma, and blood-filled
channels consistent with revascularization of a ruptured plaque have all
been described in miceref1,
ref2,
ref3,
ref4.
However, substantial anatomical, physiological, and hemodynamic differences
between human and murine plaques impose a very cautious extrapolation of
the results obtained in murine models to humans. For example, the murine
media consists of just a few cell layers and their lesions have a far greater
propensity to invade the media, often resulting in the formation of aneurysms.
Murine lesions fitting the definition of early fatty streaks, ie, consisting
mainly of foam cells, frequently cause significant stenosis that may lead
to altered flow and shear stress, whereas equivalent lesions in humans
have negligible hemodynamic consequences. Pronounced sex differences in
immune-related functions are also increasingly noted in mice, and differences
between human and murine coagulation system may existref.
Nevertheless, human and murine vulnerable plaques have many common features
and manifestations of plaque instability may be less different than presently
assumed. Murine models would be particularly attractive because of the
relative ease with which genes implicated in atherogenesis, arterial remodeling,
and plaque rupture can be manipulated in mice, and because microarrays
are available that permit the simultaneous assessment of the differential
expression of many murine genes in vivoref.
-/-)
developed by Krieger’s group are characterized by very early and extensive
atherogenesis, even when fed normal chowref.
Their coronary atherosclerosis is comparable to that in 2-year-old apoE
miceref
and shows extensive fibrin deposits indicative of plaque hemorrhage and
coagulation. Most importantly, this is associated with multiple spontaneous
infarctions with characteristic ECG abnormalities, enlarged hearts, defects
of myocardial function (reduced ejection fraction and contractility), tissue
necrosis, and deathref.
This should finally put to rest the notion that mice cannot be models of
plaque rupture, just as the development of the apoE mouse put to rest the
dogma that mice cannot develop "real" atherosclerotic lesions. It also
proves in principle that conditions in mice can be modulated to the point
where their pathogenic events mimic those in humans. This should stimulate
the development of other models. Nevertheless, models closer to the human
may still be needed to corroborate results obtained in mice. It will probably
be only a matter of time until the apoE-/- x SR-BI-/-
model will be used to investigate the mechanisms predisposing to plaque
rupture and to assess the protective effect of statins. In the meantime,
the results of Bea et alref
provide the first in vivo evidence that statins reduce plaque vulnerability
independently of cholesterol lowering. However, several caveats have to
be kept in mind. The first is the relatively high dose of statins in this
and other studies. Although a faster drug metabolism in rodents may attenuate
the physiological significance of this discrepancy, the implications in
terms of the accumulation of statins or active metabolites in cellular
membranes and lipid-rich tissues in general remain a concern. Another caveat
regards the temporary rise in cholesterol. The presumption is that statins
inhibit HMG-CoA reductase and consequently the synthesis of both cholesterol
and isoprenoids in mice, as they do in humans, and that the lack of reduction
of murine plasma cholesterol levels is solely attributable to the prevalence
of lipoprotein particles lacking the ligand for hepatic LDL receptors.
If, however, the rise in cholesterol was not coincidental and the effect
of statins on the mevanolate pathway were different from that in humans,
the relevance of the model and the present findings would be questionable.
In
vivo evidence for genuine pleiotropic effects of statins is sparse.
The present article adds reduced calcification, but offers no additional
insights into the mechanisms actually responsible for plaque instability.
Cholesterol-independent effects of statins on lesion composition that could
contribute to weakening of the cap have previously been established in
monkeysref.
Macrophage-secreted metalloproteinases are thought to be an important cause
of fibrous cap weakeningref,
although the impact of individual enzymes has not been establishedref1,
ref2,
ref3.
This assumption is strengthened by the observation that pravastatin treatment
increases collagen content and decreases lipid content, inflammation, metalloproteinase
expression, and cell death in human carotid plaquesref.
However, other protective effects of statins on macrophages, T cells, and
inflammatory conditions prevailing in plaques and potentially contributing
to plaque ruptureref
cannot be ruled out. Clearly, much more work will be necessary to establish
that specific pleiotropic effects of statins contribute to reduced plaque
vulnerability and rupture in humansref.
Atherogenesis involves the migration of monocytes into the subendothelial
spaceref,
where they adhere to matrices containing oxidized
LDLs (oxLDLs),
mature into macrophages, and secrete growth factors, proteases, and ROSref.ref
:
there is now compelling evidence that statin therapy may attenuate the
effect of inflammation on risk of cardiovascular events. Among 708 postinfarction
patients in the Cholesterol and Recurrent Events (CARE) trial, subjects
with elevated levels of CRP and SAA (>90th percentile) had a higher risk
and benefited more from therapy with pravastatin 40 mg/d than those without
elevated levels of these inflammatory markers. The relative risk of a recurrent
coronary event was reduced by 54% and 25% in the 2 groups, respectively,
compared with placeboref.
At baseline, both subsets had nearly identical plasma lipid and lipoprotein
profiles. Long-term therapy with pravastatin in the CARE trial also reduced
levels of CRP in postinfarction patientsref.
Although baseline median CRP levels for active treatment and placebo were
similar, the median level after 5 years was 21.6% lower in the pravastatin
group than in the placebo group (P=0.007). The change in CRP levels associated
with pravastatin treatment was not correlated with the reduction in LDL-cholesterol
levels. The latter finding has been confirmed in the recent 24-week prospective
Pravastatin Inflammation/CRP Evaluation (PRINCE) trialref.
A 6-week triple crossover trial compared the effect of pravastatin, simvastatin,
and atorvastatin therapy on hs-CRP levels in patients with combined hyperlipidemiaref.
All 3 drugs, at doses reported to have equivalent effects on LDL-cholesterol,
significantly reduced median hs-CRP levels (pravastatin by 20%, simvastatin
by 23%, and atorvastatin by 28%), and these reductions were not correlated
with reductions in LDL-cholesterol. This study is in contrast to the negative
result of a similar comparison using a parallel design and a 3-month exposure
with a smaller number of subjects in each subsetref.
In the Atorvastatin versus Simvastatin on Atherosclerosis Progression (ASAP)
study, aggressive statin therapy (atorvastatin 80 mg) reduced CRP levels
to a greater extent than conventional therapy (simvastatin 40 mg)ref.
Moreover, a significant correlation was found in univariate analysis between
the decrease in CRP and the reduction of intima media thickness (IMT) of
carotid artery segments. A recent study showed that simvastatin lowered
CRP within 14 daysref,
independently of LDL-cholesterol reduction. Rapid reductions in CRP levels
with statins could explain in part the early beneficial effects of these
drugs in acute coronary syndromesref.-60,
-65, and -70 antibody titers, positively related to risk of vascular
disease and cardiovascular endpoints, are significantly higher in dyslipidemic
patients with or without established coronary disease. In dyslipidemic
patients, the major dietary predictors of the variability in anti-HSP-60
titers were vitamin C, vitamin E, and total fat intakes; for anti-HSP-65
titers, vitamin C was the major predictorref.
10 mg of simvastatin or atorvastatin for 4 months significatively reduced
median antibody titers to HSP60 (17.2%), HSP65 (15.9%) and HSP70 (8.3%)
in dyslipidemic subjects. Both statins caused a reduction in median serum
CRP concentrations (45%), but significant changes were not observed in
the control patients. The effects on Hsp antibody titers were not related
to changes in serum CRP concentrations (p > 0.05). However, there was a
significant correlation between changes in antibody titers to HSP60 vs
HSP65, Hsp-60 vs Hsp-70, and HSP65 vs HSP70ref.
and IL-18
in PBMC in response to Mycobacterium
tuberculosis
synthesis in human vascular smooth muscle cells (VSMC)
in vitroref
in THP-1 human macrophagesref
expression by murine macrophages and suggest that pitavastatin could modulate
CD36-mediated atherosclerotic foam cell formationref
activity, which transfers cholesteryl ester to VLDL and LDLref.
With only few exceptionsref
simvastatin and pravastatin decrease plasma CETP activity in normolipidemic
individuals and patients with various forms of hyperlipoproteinemiaref1,
ref2,
ref3.
The mechanism responsible for this effect is unknown, but could mediate
some of the effects of statins beyond CETP effects on lipid metabolism.
Indeed, a significant relation between variation at the CETP gene locus
and the progression of coronary atherosclerosis has been demonstrated.
Moreover, the presence of a common DNA variant of the CETP gene appears
to predict benefit from treatment with statins in men with coronary heart
disease (CHD)ref.|
|
|
|||
|
|
|
|
||
| endothelial function / vasotonus | inhibition of endothelin 1 expressionref |
|
||
| increased expression and activity of endothelial nitric oxide (NO) synthaseref1, ref2 |
|
|||
| stroke protection mediated by endothelial NO synthaseref |
|
|
|
|
| preserved coronary endothelial function and coronary adventitial vasa vasorumref1, ref2 |
|
|
||
| preserves myocardial perfusion and coronary microvascular permeabilityref |
|
|
||
| macrophage and T cell recruitment / modulation of immune functions | decreased leukocyte-endothelial interactionsref |
|
|
|
| decreased CD11b expression and CD11b-dependent endothelial adhesion of human monocytesref |
|
|
||
| inhibition of endothelial cell and monocyte MCP-1 synthesis and leukocyte recruitment into air pouchref |
|
|
|
|
| decreased integrin-dependent leukocyte adhesionref |
|
|||
| inhibition of T cell activation through inhibition of MHC-II expression on APCsref |
|
|||
| inhibition of leukocyte adhesion, T cell stimulation, and peritoneal inflammation by inhibition of LF-1 (CD11a/CD18)ref |
|
|
|
|
| proinflammatory factors | inhibition of natural killer cell cytotoxicity by compactinref |
|
||
| inhibition of macrophage NO synthase and cytokines TNF, IL-1ß, IL-6ref |
|
|||
| inhibition of human B-lymphocyte activationref |
|
|||
| reduced neointimal inflammationref |
|
|
||
| anti-inflammatory and anti-atherosclerotic effectsref |
|
|
||
| reduction of IL-1ß, IL-6, COX-2, and PPAR mRNA in endothelial cellsref |
|
|||
| reduced IL-6 synthesis in VSMCsref |
|
|||
| reduced MMP-9 secretion by macrophagesref |
|
|||
| suppression of growth of macrophages expressing matrix metalloproteinases and tissue factorref |
|
|
|
|
| SMC proliferation / apoptosis of arterial cells / remodeling of the arterial wall | decreased VSMC proliferationref |
|
||
| increased apoptosis of VSMCsref |
|
|||
| increased SMC and collagen, and decreased metalloproteinases in atheromaref |
|
|
||
| modulation of angiogenesisref1, ref2 (opposite effects reported) |
|
|
|
|
| decreased metalloproteinase and increased collagen expression in plaquesref |
|
|
||
| decreased secretion of MMP-9 and THP-1 cell migrationref |
|
|||
| generation of oxygen radicals and modulation of oxidation-sensitive signaling | decreased LDL oxidation by macrophagesref |
|
||
| decreased SMC superoxide formation and reduced cardiac hypertrophyref |
|
|
|
|
| reduced production of ROS and improved endothelial dysfunction in normocholesterolemic hypertensionref |
|
|
||
| thrombosis / fibrinolysis | increased fibrinolytic activity in endothelial cellsref |
|
|
|
| decreased platelet activation and reduced cerebral ischemiaref |
|
|
||
| inhibition of tissue factor expression in macrophagesref69 |
|
|||
| reduced tissue factor expression in carotid lesionsref |
|
|
||
| reduced expression of COX-2 in the intima and in cultured VSMCsref |
|
|
|
|
| clinical trials – mechanisms unknown | clinical outcomes not entirely explained by cholesterol-lowering (reduction of strokes, protective effects at ‘normal’ cholesterol levels, etc)ref1, ref2, ref3, ref4 |
|
|
|
| improvement of clinical outcomes after relatively short treatment periodref1, ref2 |
|
|
||
| reduced graft atherosclerosis and mortality after heart transplantationref1, ref2 |
|
|
||
| reduced death after percutaneous coronary interventionref |
|
|
||
ref1,
ref2
- and in particular to the mouse model termed experimental autoimmune
encephalomyelitis (EAE)—are particularly interesting and not entirely unexpected.
Oral statin treatment prevents or reverses chronic and relapsing paralysis
and suppresses clinical and histological EAE : in these experiments, statin
treatment reduces CNS infiltration (Th1 lymphocytes) and MHC
class II expression, inhibits the activity of CD40, CD80, and CD86 co-stimulatory
molecules, largely inhibits the secretion of numbers of proinflammatory
cytokines [for example, TNF-a, IFN-g,
IL-12], and even induces the production of anti-inflammatory cytokines
[such as TGFß and IL-10]. In addition, statin treatment of either
APC or T lymphocytes from EAE-susceptible mice suppressed antigen-specific
T-cell activation. These statin-mediated effects are specific for the inhibition
of the enzyme HMG-CoA reductase. Statins may be beneficial for multiple
sclerosis and other Th1 lymphocyte-mediated autoimmune diseasesref.
These findings were largely confirmed in another recent report published
by Neuhaus et al.ref.
It is important to bear in mind that one of the current treatments of choice
for multiple sclerosis, IFN-ß, also inhibits expression of MHC
class II, although the exact mechanism is unknown. Investigations on
possible synergy between statins and IFN-ß treatment on immunomodulation
and proinflammatory molecules are currently being explored and may result
in novel therapeutic strategies to influence the clinical issue of multiple
sclerosis.ref.
Nonetheless, the future seems bright for the statin family in immune regulationref.
In the last decades, substantial progress has been made in understanding
the relationship between lipid disorders and the prevention of cardiac
ischemic diseaseref.
)
are used in treatment of ...
(camptothecin derivatives) and microtubule
depolymerizing drugs
(colchicine and podophyllotoxin) were identified. In response to treatment
with each agent, bone marrow-derived DC preparations exhibited characteristic
phenotypic and/or functional changes associated with DC activation. All
the above agents also triggered NFkB activation
in DCs, suggesting a common pharmacological mechanism of action. Furthermore,
locally administered colchicine induced in situ maturation and migration
of DCs and augmented both humoral and cellular immune responses. These
results support the practical utility of the DC-based biosensor system
to discover novel DC-targeted immunostimulants and unveil previously unrecognized
(and totally unexpected) pharmacological activities of several drugs that
are commonly used for the treatment of various disordersref.
which increases NK cells and activated T-cells : levamisole had no consistent
effect on induction of 2',5'-oligoadenylate synthetase activity or indoleamine-2,3-dioxygenase
(IDO)
activity, or production of TNF. Levamisole had no effect on monocyte cytotoxicity
or expression of HLA-DR, HLA-DQ, HLA-DP, and the Fc receptor. Similarly,
levamisole had no significant effect on NK or LAK cytotoxicity or the immunological
activation of T-lymphocytes, assessed by expression of CD3, CD4, CD8, CD16,
CD25, and CD56. Proliferation of lymphocytes from normal donors, patients
with benign polyps, and patients with malignancies, with or without IL-2
or irradiated LS174T cells, was not significantly increased overall. No
significant enhancement in the expression of 3 tumor-associated antigens
(880364, NRCO-4, and ING-1) and ICAM-1 on 4 human cancer cell lines was
observed following in vitro exposure to levamisole. Anaerobic bacteria
from human intestinal flora (expecially Bacteroides and Clostridium
spp.) catabolyze levamisole into 3 hydroxamic lactam-type, thiazole ring-opened
metabolites, namely, levametabol-I, II and III. LMS
decomposes during storage in neutral and alkaline conditions to form 3
products : 3-(2-mercaptoethyl)-5-phenylimidazolidine-2-one, 2,6-phenyl-2,3-dihydroimidazo
(2,1-b) thiazole and bis [3-(2-oxo-5-phenylimidazolidin-1-yl)
ethyl] disulfide. The formation of the products is accelerated by increasing
the temperature from 4 to 37°C
, HHV-1
/ HSV-1,
rhinoviruses,
HHV-3
/ VZV,
HBV,
and SSPE
virus
infections.,
as well as multiple
myeloma,
myelodysplastic
syndrome,
myelofibrosis
with splenic myeloid metaplasia,
chronic
lymphocytic leukemia (CLL),
and B-cell lymphomas.
Although its molecular mechanisms of action have not yet been elucidated,
thalidomide and the IMiDs affect a variety of cytokines and inflammatory
mediators including TNF-a,
IL-1b,
IFN-g,
IL-6,
IL-10,
IL-12,
and COX-2
and angiogenesis factors such as VEGF
and VEGFRs. It was originally proposed as a potential therapy for refractory
MM because of its known anti-angiogenic activity and the demonstration
of increased angiogenesis in MM BMref1,
ref2.
In addition, Thal and IMiDs induce either apoptosis or G1 growth
arrest of MM cells by multiple other mechanismsref.
They block MM cell adhesion to BMSCs and the resultant secretion of MM
growth, survival, and migratory factors (IL-6, VEGF); and enhance NK cell
number and function against human MM cellsref
grade 3-4 (4%), thrombocytopenia
(4%), emetogenic level 1ref,
neuropathyref1,
ref2,
ref3,
ref4,
teratogen (phocomelia)
when used as antiemetic or sedative in pregnants, grade 4 WHO neutropenia
with septicemiaref
transcriptional activity and act like thalidomide. The IMiDs also affect
adhesion molecules such as ICAM-1, ICAM-2, and L-CAM, in addition to preferentially
stimulating CD8 CTLs and expanding NK cell populations
(associated with a chromosome 5q deletion) who have no response to erythropoietin
or who are unlikely to benefit from conventional therapyref
enhances cytotoxicity against multiple
myeloma
cells, providing the framework for combined lenalidomide and SGN-40 in
a new treatment paradigm to both target MM cells directly and induce immune
effectors against MMref
occurred in 12-16.5% of patients and thrombosisref
inhibitors that inhibit activation-induced TNF-a
production and are highly antiangiogenic. In addition, inhibition of PDE-4
induces apoptosis in human CLL lymphocytes and has anti-inflammatory properties.
Moreover, a subset of SelCIDs has been found to posses direct anti-tumor
activity both in vitro and in vivo.
have been been used to treat cutaneous neoplasms
agonists : one advantage of the synthetic compounds is that they are
less likely to be contaminated with minor, but potent, bacterial products
that may mislead the investigator, as has been an occasional confounding
problem with LPSref1,
ref2
agonists :
agonistsref
:
agonists : mainly derivatives and analogs of guanine. Structure-activity
studies within this class showed that structures in the thiazolo[4,5-d]pyrimidineref,
pyrazolo[3,4-d]pyrimidineref,
purineref,
7-deazapurineref,
and 9-deazapurine ring systemsref
all are active. Examples in each group were found to be potent antiviral
agents in mouse models because of their ability to rapidly induce the production
of IFNref1,
ref2,
ref3
,
actinic
keratosis (AK)ref1,
ref2,
ref3,
non-melanoma skin cancers such as basal
cell carcinoma (BCC)ref1,
ref2,
ref3
and squamous
cell carcinoma (SCC)ref1,
ref2,
ref3,
lentigo
maligna / melanomaref1,
ref2,
ref3,ref4,
keratoacanthomaref,
molluscum
contagiosumref1,
ref2,
ref3,
localized morphearef1,
ref2
and fibromatosesref,
infantile
hemangiomaref,
cutaneous
T-cell lymphomaref.
In keratinocytes it upregulates IL-6 and IL-8 in vitroref.
Hydroxylated to R-842ref.
It is also an antagonist on A1
and A2A
inducing activation of NF-kB and the downstream
production of proinflammatory cytokines in the absence of TLR7 and TLR8
and in the absence of immune cells, and inhibiting adenylyl cyclase activity
downstream from the receptorref
agonist in human cells, but TLR8 in the mouse is nonfunctionalref.
Catabolized to S-28371.
agonist)ref
is an oral imidazoquinazoline agent that has been shown to reduce elevated
platelet counts and the risk of thrombosis in patients with thrombocythaemia
in various myeloproliferative disorders
(MPD)
stimulated genes.
and IL-12
production, which enhances IFN-g production.
The potential advantages of inducing Th1 responses in response
to immunization could have far-reaching consequences in the management
of infections and cancer. Many more studies are urgently needed to determine
the safety and applicability of these novel immunomodulating agents in
the therapy of HIV infection, other infectious diseases, cancer and in
the development of immunization protocols. However, they are already demonstrating
clinical utility in the therapy of genital warts, molluscum contagiosum
and, potentially, herpes genitalis. In vivo studies have confirmed
the induction of IFN-a
and TNF-a,
as well as other cytokines such as IL-12
p40, in humans and animals treated with topical imiquimod cream or resiquimod
gelref1,
ref2.
agonists :
agonists : immunostimulatory (ISS) oligodeoxynucleotides (ODN)
=> Th1-polarized
immune response. They display their adjuvant effect on the humoral immune
response by enhancing terminal differentiation of B cells into plasma cells,
but not by increasing memory B cell generation. CpG oligodeoxynucleotides
:|
|
|
|
|
| D-type CpG ODN (also known as CpG-A) | GGTGCATCGATGCAGGGGGG | mixed phosphodiester (italics)/phosphorothioate backbone
single CpG motif (blue) CpG flanking region forms a palindrome (red) poly-G tail at 3' end (green) |
APC maturation, mediated by IFN-a
preferentially stimulates pDCs
to secrete IFN-a,
which promotes memory-cell proliferation but have anti-proliferative
effect on naive T-cells; marked increase in the frequency of
IFN-g-producing CD8+
T cells after stimulation with an influenza peptide (memory CD8+
T cells) but not Melan-A peptide (naive
CD8+ T cells) (stronger upregulation of CD56 and increase in
lytic activity associated with an increase in intracellular
levels of granzyme B, compared with CpG-B)ref |
| K-type CpG ODN (also known as CpG-B) | TCCATGGACGTTCCTGAGCGTT | phosphorothioate backbone
multiple CpG motifs (blue) 5' motif most stimulatory |
pDC
maturation and production of TNF-a(but
not IFN-a)
triggers B-cell proliferation and IgM and IL-6
production; most efficient at priming naive T cells to produce
CTLs; marked increase in the frequency of IFN-g-producing
CD8+ T cells after stimulation with
either an influenza peptide (memory CD8+ T cells) or a Melan-A
peptide (naive CD8+ T cells)ref |
| C-type CpG ODN | TCGTCGTTCGAACGACGTTGAT | phosphorothioate backbone
multiple CpG motifs (blue) TCG dimer at 5' end (purple) CpG motif imbedded in a central palindrome |
stimulates B cells to produce IgM and IL-6
activates pDCs
to secrete IFN-a |
|
|
|
|
|
|
|
|
| toxins | K | Clostriudium
tetani
toxoid |
mouse | systemic, oral | IgG | yesref |
| K | Corynebacterium
diphteriae
toxin |
mouse | systemic | IgG | yesref | |
| viruses | K | measles virus |
neonatal mice | systemic | IgG2a, Th1 |
N.D.ref |
| K | HBV |
mouse | intranasal | IgG, IgA | N.D.ref1, ref2 | |
| K | HHV-5 / CMV |
mouse | systemic | IgG | N.D.ref | |
| K | influenzaviruses |
mouse | mucosal | IgG | N.D.ref | |
| bacteria | K | Brucella
melitensis biovar abortus 544 |
mouse | systemic | IgG, IFN-g | yesref |
| K | Bacillus
anthracis |
mouse, monkey | systemic | IgG | yes | |
| K | Mycobacterium
tuberculosis |
guinea pig | systemic | IgG, DTH | N.D.ref | |
| parasites | K | Plasmodium chabaudi AS malaria | mouse | systemic | IgG2a, IFN-g | yesref |
| K, D | Leishmania major |
mouse, monkey | systemic, ID | IFN-g | yesref1, ref2 | |
| K | Trypanosoma cruzi |
mouse | systemic | IgG2a | yesref | |
inhibitors
induce the expression of proteolytic and regulatory subunits of the immunoproteasome,
increase the half-life of MHC class I complexes, and enhance the sensitivity
of neuroblastoma cells to both MHC class I-restricted peptide-specific
and HLA nonrestricted lysis by CTLs. Importantly, effects of retinoids
on the MHC class I pathway appear to be independent of IFN-g
and/or TNF-a
as intermediate messengers. To our knowledge, this is the first demonstration
of inflammation-unrelated biological molecules that induce systemic modulation
of antigen presentation in nonprofessional antigen presenting cellsref
(European mistletoe) : viscotoxins (VT) and mistletoe lectins
(ML) / viscumins / Viscum album agglutinins increase natural
killer (NK) cell-mediated killing of tumor cells by acting on cell conjugates
to increase the resulting lysis but spare nontarget cells from NK lysisref,
induce apoptosis in lymphocytes and tumor cells via IL-4ref
and activate granulocytesref))ref1,
ref2
or ABCG8 / sterolin-2,
they are difficult to absorb during the transit of digested food through
the gut, particularly in individuals with impaired digestive function.
For this reason, and because much of the modern diet is over-processed
and low in fresh plant materials, sterols and sterolins appear in the serum
and tissue of healthy humans at 800-1000 times lower concentrations than
that of cholesterol.
to a Th1
polarization, dampening overactive antibody responses, and normalizing
DHEA:cortisol
ratios. Research has shown plant oils contain the highest concentration
of phytosterols, nuts and seeds contain moderate amounts, and fruits and
vegetables generally contain the lowest phytosterol concentrations.
: multiple factors influence the formation, progression, and metastasis
of tumors in vivo. It is increasingly recognized that tumor-derived
molecules may play an important role in enhancing tumor formation either
by acting directly on the tumor cell or on the host. In these ways, tumor-derived
factors may alter the tumor microenvironment in such a manner as to enhance
tumor cell survival or modify the host responses to the tumor. One class
of tumor-derived molecules that has received recent attention is the tumor-derived
gangliosidesref.
These sialic acid-containing glycosphingolipids, which are components of
the outer leaflet of the cell membrane, are actively shed by tumor cellsref1,
ref2,
ref3,
ref4
and taken up by the host cells in the tumor microenvironmentref.
The biological properties and actions of tumor gangliosides have now been
well documented. These include potent immunosuppressive activityref1,
ref2,
ref3,
ref4,
proangiogenic propertiesref1,
ref2,
ref3,
and, more recently, enhancement of growth factor-mediated fibroblast and
vascular endothelial cell proliferationref1,
ref2,
ref3.
Increased expression of gangliosides has been associated with enhanced
tumor formationref,
and a correlation has been established between the expression and/or shedding
of certain gangliosides and accelerated tumor progression in human tumors,
such as neuroblastomaref.
These combined findings implicating tumor gangliosides as having important
roles in tumor formation and progression have led to our hypothesis that
reduced ganglioside synthesis and shedding could result in decreased tumor
incidence, impeded tumor progression, and/or decreased metastasis. This
was documented in vivo in an experimental system in an indirect manner,
by demonstrating that the addition of purified tumor gangliosides enhanced
the tumorigenicity of a poorly tumorigenic, ganglioside-deficient murine
lymphoma cell lineref.
Adding further support to this concept, pharmacologically induced cellular
ganglioside deficiency resulted in a reduction of melanomaref
and brain tumorref
formation in mice. Transfection of an antisense sequence to glucosylceramide
synthase, the enzyme catalyzing the initial step in the synthesis of all
glucosylceramide-based glycosphingolipids, inhibits tumor formation in
syngeneic murine orthotopic MEB4 melanomaref.
These data demonstrate high ganglioside expression in tumors, a biological
role of gangliosides, and the possibility of inhibition of expression by
certain strategies. This suggests that a practical strategy for pharmacologic
induction of cellular ganglioside deficiency could be a promising and novel
therapeutic approach to human cancer. This possibility was systematically
evaluated in the above orthotopic model of murine melanomaref.
We studied a novel inhibitor of glucosylceramide synthase that can be administered
systemically, the imino sugar OGT2378, a molecule related to NB-DNJ3 (OGT918),
which has been shown to be effective in the treatment of type
1 Gaucher’s diseaseref.
Both a potent inhibitory effect on glycosphingolipid synthesis in the MEB4
melanoma cell line, without antiproliferative or cytotoxic effects in
vitro, and marked inhibition of melanoma tumor growth in vivo
after p.o. administration of OGT2378 were demonstrated. The rationale for
using inhibitors of glycosphingolipid synthesis as a therapeutic approach
to tumors derives from substantial data supporting a role for gangliosides
in the process of tumor formation. From the initial description of tumor
cell ganglioside shedding and immunosuppressive activityref,
to the correlation and direct evidence for a role in tumor formation in
miceref,
and a link with tumor progression in humansref,
the accumulated findings of many laboratories have now established a biological
role for gangliosides in a number of tumor systemsref.
The possibility that inhibition of ganglioside synthesis by tumor cells
may decrease tumor cell ganglioside content and impede tumor progression
has been of recent interestref.
In vitro studies have shown that the inhibition of ganglioside synthesis,
e.g., by inhibitors of glucosylceramide synthase, results in decreased
ganglioside sheddingref,
which in turn has been associated with a reduced inhibitory effect on the
host immune response and reduced enhancement of normal growth factor-induced
endothelial cell and fibroblast proliferationref1,
ref2.
Treatment of tumor cells in vitro with two inhibitors of glucosylceramide
synthase, D-threo-1-phenyl-2-decanoylamino-3-morpholino-1-propanol
and PPPP, has resulted in decreased ganglioside content and decreased tumor
formationref1,
ref2,
ref3.
However, PPPP is highly toxic and cannot be administered in vivo.
Recently, glucosylceramide synthase antisense clones, which have decreased
ganglioside content but only marginally increased ceramide and no significant
increase in apoptosisref,
have also shown inhibited tumor formation, compared with untransfected
or sense-transfected control cells. Together, these studies have suggested
that this inhibition of tumor cell ganglioside expression may be a viable
approach to cancer treatment. Whether systemic treatment with an inhibitor
of glucosylceramide synthase would be feasible in this context has not
been well studied; there is one report that NB-DNJ reduced tumor cell proliferation
in vitro and tumor formation in vivo in a murine brain tumorref.
On the other hand, there has already been substantial interest in the use
of inhibitors of glucosylceramide synthase to treat glycolipid storage
diseases by substrate reduction (e.g., Gaucher’s diseaseref),
and NB-DNJ has been used with success in this manner in humansref.
Thus, inhibition of glycosphingolipid synthesis has been identified as
a therapeutic target in glycolipid storage disease. Administration of a
new imino sugar, OGT2378, caused highly effective depletion of gangliosides
in vivo and particularly of tumor tissue gangliosides. A relevant tumor
system, namely an orthotopic model of melanoma, generated by intradermal
injection of MEB4 melanoma cells, was used to study its effect on
tumor formationref1,
ref2.
In this syngeneic tumor model, the continuous p.o. administration of OGT2378,
in the diet, was well tolerated and resulted in highly significant inhibition
of tumor growth, even when treatment was initiated only after establishment
of the tumor. In addition, the fact that in the present study we found
no inhibition of tumor cell proliferation in vitro is of importance
because it reduces the likelihood of side effects in vivo caused
by a direct cytotoxic or antiproliferative effect of the drug. These findings
underscore the potential significance of ganglioside metabolism as a new
therapeutic target and suggest promise for OGT2378 as an example of a potentially
very effective new approach to interfering with tumor progressionref,
alopecia areata,
and even skin cancers.
Most of these studies have utilized these powerful topical immunomodulators
in acetone, a volatile solvent that precludes development of contact sensitizers
as products. These problems have been overcome and stabilized these topical
immunomodulators in a non-volatile, nonirritating GRAS (generally regarded
as safe) vehicle. The current review article covers the traditional use
of contact sensitizers for a variety of benign and malignant conditions
and discusses possible mechanisms in relation to developments in modem
molecular immunodermatologyref.
in G6PD deficitary individuals), drug
rash with eosinophilia and systemic symptoms (DRESS)
,
stomatitis,
anorexia,
ageusia,
nausea
and vomiting,
cough,
glomerulonephritis with nephrotic
syndrome,
drug-induced
pemphigus
(5%), autoimmune
thyroid diseases,
myasthenia
gravis,
aplastic
anemia,
leukopenia,
thrombocytopenia,
drug
rash with eosinophilia and systemic symptoms (DRESS).
selective inhibitors (CSI) : generally prohibit taking the pills for
> 10 days in a row. Many of the diseases helped by fish oils (from asthma
to heart disease) have one thing in common: chronic inflammation, in which
immune cells and molecular mediators flood tissues and can create damage.
This can lead, for example, to the arteriosclerosis that spurs heart attacks
and strokes. In a 1999 study subjects had consumed 1 g of fish oil each
day and were protected from cardiovascular diseases, but that almost all
of the subjects were also taking aspirin to prevent strokes and heart attacks.
Aspirin speeds up the conversion of w-3 fatty
acids (essential fatty acid eicosapentaenoic acid (EPA)) in the fish oil
into lipids that seem to suppress inflammation. First they found that healthy
human volunteers fed both aspirin and fish oil had resolvin E1 (RvE1)
/ 5S,12R,18R-trihydroxy-6Z,8E,10E,14Z,16E-EPA
in their bloodstream. A synthetic form of the lipid inhibits the migration
of human dendritic cells, dramatically reduced inflammation on the skin
of rabbits and works in a mouse model of periodontal gum diseaseref.|
|
|
|
|
|
| aspirin | ++ | ++ | ++ | |
| indomethacin | ++ | ++ | ||
| naproxen | + | 250-500 mg, twice daily | ||
| fenoprofen | 300-600 mg, 3-4 times a day | |||
| ibuprofen | ++ | 400-800 mg, 3-4 times a day | ||
| ketoprofen | 50-75 mg, 3-4 times a day | |||
| flurbiprofen | 50-75 mg, 2-4 times a day | |||
| oxaprozin | 600-1200 mg, once daily | |||
| diclofenac | ++ | ++ | ||
| ketorolac | + | ++ | ||
| piroxicam | ++ | ++ | ||
| meloxicam | ++ | ++ | ||
| phenylbutazone | +++ (no longer used) | |||
| nimesulide | + | + (reduces diuresis) | ||
| acetaminophen | ++ | ++ | + (fulminating hepatitis) | |
| tramadol | ++ |
,
papillary necrosis, acute interstitial nephritis, hyperazotemia, ARF, nephrosic
syndrome) => systemic
arterial hypertension
?. A higher relative risk of thrombotic
cardiovascular complications
has recently emerged in studies evaluating the use of NSAIDs such as rofecoxib,
celecoxib, and naproxen. Direct pro-thrombotic effects of selective COX-2
inhibition were originally speculated to be the potential mechanism behind
these results, but this proposal fails to explain the pro-thrombotic effects
of non-selective NSAIDs. The paradoxical pro-inflammatory, pro-thrombotic
effects associated with chronic use of anti-inflammatory agents might be
attributable to compensatory host response rather than direct effects of
the drugs. Chronic pharmacologic inhibition of inflammation may induce
physiologic dependence, and cessation of therapy has been shown to produce
rebound effects in aspirin, statins, and other immunomodulatory agents.
By down-regulating inflammatory pathways in a pulsatile fashion, chronic
use of NSAIDs may promote compensatory up-regulation of these same pathways
and shift the host baseline equilibrium towards an inflammatory state.
The host may be susceptible to inflammation between intermittent doses
and after withdrawal of therapy. Inflammation is a promoter of adrenergia
and thrombosis, and the constellation of these effects may predispose to
excess risk of acute cardiovascular eventsref.
and osteoarthritis experienced significantly higher risks of oedema and
systemic
arterial hypertension
than did those using celecoxibref
and heart
attack.
Vioxx was yanked from the market after dramatic testimony by whistle-blower
David Graham, who claimed that CDER
officials had tried to prevent him from disseminating information about
the danger of the drug. An increased risk of myocardial infarction had
been observed in 2000 in the Vioxx Gastrointestinal Outcomes Research study
(VIGOR), but was attributed to cardioprotection of naproxen rather than
a cardiotoxic effect of rofecoxib. By the end of 2000 (52 myocardial infarctions,
20742 patients) the relative risk from randomised controlled trials was
2.30 (95% CI 1.22-4.33, p=0.010), and 1 year later (64 events, 21432
patients) it was 2.24 (1.24-4.02, p=0.007). There was little evidence
that the relative risk differed depending on the control group (placebo,
non-naproxen NSAID, or naproxen; p=0·41) or trial duration (p=0·82).
In observational studies, the cardioprotective effect of naproxen was small
(combined estimate 0·86 [95% CI 0.75-0.99]) and could not have explained
the findings of the VIGOR trial. Rofecoxib should have been withdrawn several
years earlier. The reasons why manufacturer and drug licensing authorities
did not continuously monitor and summarise the accumulating evidence need
to be clarifiedref.
27,785 heart attacks between 1999 and 2003 have been attributed to Vioxx
use. 2.5 billions of US$ were revenue from Vioxx sales in 2003. 28 billions
of US$ were lost in shareholder value after Vioxx was pulled from the market.
Among 1.4 million Californians who had used anti-inflammatory drugs, users
of Vioxx were between 1.6 and 3.6 times more likely to experience heart
trouble than users of celecoxib. By combining data from Merck's clinical
trials with data on how many patients took Vioxx, the group concluded that
the drug had caused between 88,000 and 140,000 cases of coronary heart
disease or heart attacks in the USA before it was withdrawn from saleref.
Almost 66% of new prescriptions written between 1999 and 2002 went to patients
who were not at risk of internal bleeding. By 2002 only 39% of patients
receiving the class of drugs that includes Vioxx actually needed that type,
rather than earlier types of painkillerref.
An advisory panel had pointed out that participants on celecoxib had a
2.5-fold increased risk of major heart problems compared with those taking
a placeboref,
but was suspended after the recall of rofecoxib. However, this trial data
show no increased heart risk for participants taking celecoxib, even after
3 years, but there was a roughly 50% increase in risk of heart problems
for those taking the naproxen, which belongs to a class of painkiller that
is sold over the counter and to which ibuprofen also belongs. There are
no trials of the long-term use of this type of painkiller, but Breitner's
independent safety panel decided on 10 Dec that the naproxen risks were
minor. It recommended that the study continue and it was actually the fears
of the participants that made Beringer decide to pull the plugref.
: nausea, vomiting, peptic
gastric ulcer
(inhibition of PGE2
synthesis => decrease of mucus secretion) => gastro-intestinal hemorrhages
(expecially from celecoxib), exanthemas, hemorrhages (inhibition of TxA2
synthesis), rarely hepatopathies
: urticaria, pruritus, bullous dermatitis
is not associated with such an excessref
or IKK-b inhibitors prevent multiple
organ dysfunction syndrome (MODS)
that is normally triggered by gut ischemia-reperfusion but also result
in severe apoptotic damage to the reperfused intestinal mucosa. These results
show the dual function of the NF-kB system,
which is responsible for both tissue protection and systemic inflammation,
and underscore the caution that should be exerted in using NF-kB
and IKK inhibitors.
antagonists
antagonists
antagonists
antagonists
antagonists
Copyright © 2001-2005 Daniele Focosi.
All rights reserved | Terms
of use | Legal
notices
|
|
|
|
|
